Codon Usage Calculator

Analyze codon usage patterns, frequency, and relative synonymous codon usage (RSCU) in coding sequences.

Sequence Input

DNA sequences (T) will be automatically converted to RNA (U)

RSCU (Relative Synonymous Codon Usage)

RSCU = 1.0 means the codon is used at expected frequency. Greater than 1.0 indicates preferential usage, less than 1.0 indicates underuse.

Sequence Summary

12 codons
11 unique codons used

GC Content by Position

1st Position (GC1)41.7%
2nd Position (GC2)25.0%
3rd Position (GC3)83.3%
Total GC Content50.0%

Codon Usage Table

CodonAACountFreq%RSCU
AUGM (Met)216.7%1.00
GCCA (Ala)18.3%4.00
AAGK (Lys)18.3%1.00
CUGL (Leu)18.3%6.00
UACY (Tyr)18.3%2.00
GAGE (Glu)18.3%2.00
AAAK (Lys)18.3%1.00
UUUF (Phe)18.3%2.00
GGGG (Gly)18.3%4.00
UAG* (Stop)18.3%3.00
CCCP (Pro)18.3%4.00

Codon Usage Calculator: Overview

The codon usage calculator reads an mRNA or DNA coding sequence, splits it into three-letter codons, and reports how often each codon appears, the relative synonymous codon usage (RSCU) of every codon, and the GC content at each codon position. Codon usage analysis is a cornerstone of molecular biology, synthetic gene design, and comparative genomics, because the genetic code is degenerate: most amino acids are encoded by more than one codon, yet organisms strongly prefer some of those synonymous codons over others. Measuring that preference, known as codon bias, is exactly what this calculator does.

You paste a sequence into the input box and the calculator immediately cleans it. Lowercase letters are converted to uppercase, thymine (T) from DNA is rewritten as uracil (U) so the tool always works in RNA terms, and any character that is not A, U, G, or C is stripped out so spacing, line breaks, FASTA gaps, or stray digits do not break the analysis. The cleaned sequence is then read three nucleotides at a time, in frame from the first base, and each valid codon is tallied against the standard genetic code table.

The results give a complete picture of the coding sequence: the total number of codons, how many distinct codons were used, a sortable codon usage table listing count, percentage frequency and RSCU for every codon, and a breakdown of GC content at the first, second, and third codon positions. Because the third position is the most degenerate, its GC value (GC3) is a classic indicator of codon bias and is widely used when designing genes for codon optimization in heterologous expression hosts such as E. coli, yeast, or mammalian cells.

How the Codon Usage Calculation Works

The calculator first normalises your input, then walks the cleaned sequence in steps of three bases, starting at position 0 and stopping when fewer than three bases remain. Each three-letter window is looked up in the standard codon table; if it is a recognised codon, the tool increments the count for that codon, increments the count for the amino acid it encodes, and increments the running total of codons. Stop codons (UAA, UAG, UGA) are counted as codons too, listed under the "Stop" amino acid.

For every codon that appears, the calculator computes two numbers. The plain frequency is the codon's count divided by the total number of codons, expressed as a percentage. The RSCU compares how often a codon is used against how often it would be used if all synonymous codons for its amino acid were chosen with equal probability. If an amino acid is encoded by n synonymous codons, the expected fraction for each is 1/n. The observed fraction is the codon's count divided by the total number of codons for that same amino acid. Dividing observed by expected gives the RSCU.

Algebraically the two relationships simplify neatly: the RSCU equals the codon count multiplied by the number of synonymous codons for that amino acid, divided by the total codons used for the amino acid. An RSCU of exactly 1.0 means the codon is used at the unbiased expected rate; values above 1.0 mark preferred (over-represented) codons and values below 1.0 mark under-used codons. The sum of RSCU values across all synonymous codons for one amino acid always equals the number of those synonymous codons.

Codon Frequency and RSCU Formulas

Frequency% = (count / totalCodons) × 100 ; RSCU = (count / totalForAA) / (1 / n) = count × n / totalForAA

Where:

  • count= Number of times this specific codon appears in the sequence
  • totalCodons= Total number of valid codons read from the cleaned sequence
  • totalForAA= Total number of codons encoding the same amino acid as this codon
  • n= Number of synonymous codons that encode this codon's amino acid
  • RSCU= Relative synonymous codon usage; 1.0 = unbiased, >1.0 = preferred, <1.0 = avoided

GC Content at Codon Positions (GC1, GC2, GC3)

Beyond per-codon statistics, the calculator measures GC content by codon position. For each codon it checks whether the first, second, and third base is a guanine (G) or cytosine (C). The GC1 value is the count of G or C bases at the first position of every codon divided by the total number of codons, as a percentage. GC2 and GC3 are computed the same way for the second and third positions. The overall GC content is the sum of all G and C bases across the three positions divided by three times the total codon count.

These position-specific values are biologically meaningful. The first and second codon positions are heavily constrained by the amino acid being encoded, so GC1 and GC2 tend to reflect protein composition. The third position, by contrast, is "wobble"-tolerant: a change there often leaves the encoded amino acid unchanged. As a result, GC3 is largely free to drift toward an organism's genomic GC preference and is one of the most informative single statistics for detecting codon bias.

When you design a synthetic gene for expression in a new host, matching the host's typical GC3 and preferred codons can dramatically improve translation efficiency and protein yield. A coding sequence with extreme GC3 relative to the expression host is a red flag that codon optimization may be needed. Reading GC1, GC2, GC3, and total GC together gives a quick fingerprint of a gene's compositional strategy.

Interpreting RSCU Values and Codon Bias

RSCU is the heart of codon bias analysis. Because it is normalised by the number of synonymous codons, RSCU lets you compare preference fairly across amino acids that have anywhere from one to six codons. Methionine (AUG) and tryptophan (UGG) each have a single codon, so their RSCU is always 1.0. Leucine, serine, and arginine each have six synonymous codons, so a strongly preferred codon among them can reach an RSCU as high as 6.0 if every instance uses that one codon.

In the calculator's codon usage table, RSCU values above 1.5 are highlighted as clearly preferred and values below 0.5 as clearly avoided, giving you an at-a-glance map of the sequence's bias. A flat table with most RSCU values near 1.0 indicates little codon bias, typical of short sequences or organisms with weak selection on codon usage. A spiky table with several values well above 1.0 and others near 0 indicates strong bias, common in highly expressed genes where translationally optimal codons dominate.

  • RSCU = 1.0: Codon used exactly at the unbiased expected rate.
  • RSCU > 1.0: Codon over-represented (preferred) for its amino acid.
  • RSCU < 1.0: Codon under-represented (avoided) for its amino acid.
  • RSCU = 0: A synonymous codon that exists but never appears in this sequence.

Remember that RSCU is computed only over the codons actually present in your input. For a meaningful codon usage profile you need a reasonably long coding sequence; very short inputs produce noisy RSCU values dominated by sampling. For genome-wide reference tables, codon usage is aggregated across thousands of genes, which is why published organism codon tables are far smoother than the bias measured from a single short sequence.

Applications in Molecular Biology and Gene Design

Codon usage analysis appears throughout modern molecular biology. The most common practical use is codon optimization: when expressing a gene from one organism in a different host, scientists rewrite the coding sequence using the host's preferred codons while keeping the encoded protein identical. This calculator lets you inspect a native sequence's codon usage and GC profile before and after optimization, so you can see how the codon distribution shifts.

  • Heterologous protein expression: Compare a gene's codon usage with the preferred codons of E. coli, yeast, insect, or mammalian cells to predict and improve expression.
  • Synthetic biology: Design synthetic genes and operons with controlled GC3 and balanced codon usage for predictable translation.
  • Comparative genomics: Quantify codon bias across genes or species to study selection, mutation pressure, and gene expression level.
  • mRNA therapeutics and vaccines: Tune codon usage and GC content to influence mRNA stability and translation efficiency.

Because the tool also reports GC1, GC2, and GC3 separately, it doubles as a quick check of compositional strategy. Researchers studying the evolution of codon usage often plot GC3 against measures such as the effective number of codons; this calculator provides the raw GC3 number for any sequence you paste. Whether you are a student learning the genetic code, a graduate researcher optimizing an expression construct, or a bioinformatician profiling a genome, the codon usage calculator turns a raw sequence into interpretable codon statistics in one step.

Assumptions and Limitations

The calculator assumes your input is an in-frame coding sequence read from the first base. It does not search for a start codon or determine the correct reading frame, so if your sequence begins mid-codon the codon tallies will be shifted. For accurate results, supply a sequence that begins at the first base of the first codon, ideally starting with the AUG start codon.

It uses the standard genetic code only. Mitochondrial genomes, some protozoa, and certain bacteria use alternative codon tables in which a few codons encode different amino acids or act as stop codons; for those sequences the amino-acid assignments here will not apply. The tool also treats every recognised triplet as a coding codon, including internal stop codons, so a sequence with a premature stop will still be counted in full rather than truncated.

Finally, RSCU and GC statistics from a single short sequence are estimates with real sampling noise. A handful of codons cannot reliably represent an organism's codon preferences, and rare amino acids may be represented by only one or two codons, making their RSCU swing widely. Use this codon usage calculator for analysing individual genes, teaching the genetic code, and quick codon-optimization checks, and rely on genome-scale reference tables when you need an organism's definitive codon usage profile.

Worked Examples

Codon Counts from a Short mRNA

Problem:

Analyse the sequence AUGGCCAAGCUGUACGAGAAAUUUGGGUAGAUGCCC and find the total codons and how many are unique.

Solution Steps:

  1. 1Clean the sequence: it already contains only A, U, G, C, so nothing is stripped; length = 36 bases.
  2. 2Read in frame, three bases at a time: AUG GCC AAG CUG UAC GAG AAA UUU GGG UAG AUG CCC.
  3. 3That is 36 / 3 = 12 codons total, so totalCodons = 12.
  4. 4List distinct codons: AUG appears twice; the other 10 codons each appear once, giving 11 unique codons.

Result:

Total codons = 12; unique codons = 11 (AUG is the only repeated codon).

RSCU for Synonymous Leucine Codons

Problem:

For the sequence CUGCUGCUACUU (all leucine codons), compute the RSCU of CUG. Leucine has 6 synonymous codons.

Solution Steps:

  1. 1Split into codons: CUG, CUG, CUA, CUU — four leucine codons, so totalForAA = 4.
  2. 2CUG appears twice, so count = 2; the number of synonymous codons for Leu is n = 6.
  3. 3RSCU = count × n / totalForAA = 2 × 6 / 4 = 12 / 4.
  4. 4Frequency of CUG = (count / totalCodons) × 100 = (2 / 4) × 100 = 50%.

Result:

RSCU(CUG) = 3.00 (strongly preferred), with CUG making up 50% of the codons; CUA and CUU each have RSCU = 1.50.

GC Content by Codon Position

Problem:

Find GC1, GC2, GC3, and total GC for the sequence GCCGCAGCG (three alanine codons).

Solution Steps:

  1. 1Split into codons: GCC, GCA, GCG — totalCodons = 3.
  2. 2First position bases are G, G, G — all G/C, so GC1 = (3 / 3) × 100 = 100.0%.
  3. 3Second position bases are C, C, C — all G/C, so GC2 = (3 / 3) × 100 = 100.0%.
  4. 4Third position bases are C, A, G — two are G/C, so GC3 = (2 / 3) × 100 = 66.7%; total GC = (3 + 3 + 2) / (3 × 3) × 100 = 88.9%.

Result:

GC1 = 100.0%, GC2 = 100.0%, GC3 = 66.7%, total GC = 88.9%.

RSCU of a Single-Codon Amino Acid

Problem:

A sequence contains the codon AUG twice (methionine). What is its RSCU and frequency if the sequence has 10 total codons?

Solution Steps:

  1. 1Methionine is encoded by only one codon, AUG, so n = 1 synonymous codon.
  2. 2All methionine codons are AUG, so count = totalForAA = 2.
  3. 3RSCU = count × n / totalForAA = 2 × 1 / 2 = 1.00 — single-codon amino acids always give RSCU = 1.0.
  4. 4Frequency = (count / totalCodons) × 100 = (2 / 10) × 100 = 20%.

Result:

RSCU(AUG) = 1.00 (unbiased by definition); AUG accounts for 20% of all codons in this sequence.

Tips & Best Practices

  • Start your sequence at the AUG start codon so the reading frame is correct from the first base.
  • Paste DNA or RNA freely; thymine is converted to uracil and non-ACGU characters are removed automatically.
  • Use longer sequences for meaningful RSCU values; short inputs produce noisy, sampling-dominated bias.
  • Watch GC3 as the key indicator of codon bias, since the third position is the most wobble-tolerant.
  • Treat RSCU above 1.5 as a clearly preferred codon and below 0.5 as a clearly avoided one.
  • Remember single-codon amino acids (Met/AUG and Trp/UGG) always show RSCU = 1.0 by definition.
  • Compare a gene's preferred codons with your expression host before codon-optimizing a construct.
  • Strip introns and untranslated regions first; only the coding sequence should be analysed for codon usage.

Frequently Asked Questions

It reads a coding sequence in frame, counts how many times each three-letter codon appears, and reports each codon's percentage frequency and its relative synonymous codon usage (RSCU). It also breaks down GC content at the first, second, and third codon positions. Together these numbers describe a sequence's codon bias and compositional strategy.
RSCU stands for relative synonymous codon usage. It compares how often a codon is used with how often it would be used if all synonymous codons for its amino acid were equally likely. An RSCU of 1.0 means unbiased use, a value above 1.0 means the codon is preferred, and a value below 1.0 means it is avoided. Single-codon amino acids such as methionine and tryptophan always have an RSCU of 1.0.
You can paste either. The calculator automatically converts thymine (T) to uracil (U), so a DNA coding sequence is treated as the equivalent mRNA. It also uppercases lowercase letters and removes any character that is not A, U, G, or C, so spaces, line breaks, and FASTA formatting will not break the analysis.
The third base of a codon is the most degenerate, meaning changes there often do not alter the encoded amino acid. Because this position is relatively free from protein-coding constraints, GC3 tends to track an organism's genomic GC preference and is one of the clearest single indicators of codon bias and mutation pressure. Comparing a gene's GC3 with its expression host is a common step in codon optimization.
No. It reads the cleaned sequence in frame starting from the very first base, so you must supply a sequence that begins at the first base of the first codon, ideally the AUG start codon. If your sequence starts mid-codon, every codon downstream will be shifted and the counts will be incorrect.
It uses the standard genetic code, the table that applies to the vast majority of nuclear genes. Organisms or organelles that use alternative codon tables, such as mitochondria or certain bacteria and protozoa, reassign a few codons, so amino-acid labels for those sequences may not match. The codon counting and GC statistics, however, remain valid regardless of the code used.

Sources & References

Last updated: 2026-06-05

💡

Help us improve!

How would you rate the Codon Usage Calculator?

<>

Editorial Note

MyCalcBuddy Editorial Team

This page is maintained as an educational calculator reference.

Source

Formula Source: Standard Mathematical References

by Various

UpdatedLast reviewed: May 2026
CheckedFormula checks are based on standard references and internal QA review.

Privacy choices

MyCalcBuddy uses necessary storage for the site to work. Optional analytics, notifications, and future advertising features stay off unless you allow them.