DNA GC Content Calculator

Analyze nucleotide composition and calculate GC/AT content of DNA or RNA sequences

Enter Sequence

Non-nucleotide characters will be ignored

Nucleotide Counts

Adenine (A)6
Thymine (T)6
Guanine (G)7
Cytosine (C)6

GC Content

52.0%

13 bases

AT Content

48.0%

12 bases

Sequence Statistics

GC Content52.0%

Total Length

25 bp

Type

DNA

GC Skew

0.077

AT Skew

0.000

GC Content Interpretation

Optimal GC content range for most applications

About GC Content

GC content is the percentage of guanine (G) and cytosine (C) bases in a DNA or RNA sequence. It is an important parameter in molecular biology because:

  • Thermal Stability: Higher GC content increases DNA melting temperature due to three hydrogen bonds between G-C pairs
  • Primer Design: Optimal primers typically have 40-60% GC content
  • Genome Analysis: GC content varies between organisms and can indicate evolutionary relationships
  • PCR Optimization: High GC regions may require special conditions or additives

What Is GC Content?

GC content is the percentage of nucleotides in a DNA or RNA sequence that are either guanine (G) or cytosine (C). Because G always pairs with C through three hydrogen bonds, while adenine (A) pairs with thymine (T) — or uracil (U) in RNA — through only two, the GC ratio of a sequence directly influences how tightly the double helix is held together. This DNA GC content calculator scans your sequence, counts every base, and reports GC content, AT content, GC skew, and AT skew so you can characterize a primer, an amplicon, a gene, or an entire genome in seconds.

The calculator first cleans your input: it converts everything to uppercase and discards any character that is not A, T, G, C, or U. That means you can paste a FASTA sequence with line breaks, spaces, or numbering and the tool will simply ignore the non-nucleotide characters. If the cleaned sequence contains a U, the calculator recognizes it as RNA and labels the second base "Uracil (U)" instead of "Thymine (T)". The remaining length becomes the denominator for every percentage, so deletions or masked regions do not distort the result.

GC content is one of the most widely reported descriptors in molecular biology. It appears in every primer-design report, every PCR troubleshooting guide, and every genome paper. Knowing the GC content of a region tells you roughly how stable it will be, how hot you can run a denaturation step, and whether you should expect difficult secondary structures. For that reason, a fast, reliable GC content calculator is a staple of the bench biologist's toolkit.

How GC Content Is Calculated

The core formula used by this calculator is deliberately simple. After cleaning the sequence, the tool counts the guanine and cytosine bases, adds them together, divides by the total cleaned length, and multiplies by 100 to express the result as a percentage. AT content is computed the same way from adenine plus thymine (and uracil, when present), and because every base is one of the five recognized nucleotides, GC content and AT content always sum to exactly 100%.

The calculator also reports two strand-asymmetry metrics. GC skew measures whether guanine or cytosine dominates a strand and is defined as (G − C) / (G + C). AT skew is the analogous (A − T) / (A + T). A skew of zero means the two bases are balanced; a positive value means the first base (G or A) is in excess. These skews are widely used in genomics to locate replication origins and terminuses, where the sign of GC skew typically flips. Both skews range from −1 to +1.

One subtlety worth knowing: the GC and AT percentages count uracil as part of the AT (really "AU") fraction, but the AT skew is computed strictly from A and T counts. For a pure RNA sequence with no thymine, the AT skew therefore reflects the A versus T balance only, which is why an RNA strand can report an AT skew that looks unexpected. The percentages, however, always behave intuitively.

GC Content and Skew Formulas

GC% = (G + C) / N × 100 | GC skew = (G − C) / (G + C)

Where:

  • G= Number of guanine bases in the cleaned sequence
  • C= Number of cytosine bases in the cleaned sequence
  • A= Number of adenine bases
  • T= Number of thymine bases (or uracil U in RNA, counted toward AT content)
  • N= Total length of the cleaned sequence (A + T + G + C + U)

Interpreting Your Results

Once the calculator returns a percentage, the next question is what it means for your experiment. As a rule of thumb, the tool flags three ranges that map onto the interpretation messages shown beside your result:

GC Content Interpretation Practical Effect
Below 40% Low GC Lower melting temperature; primers may bind weakly
40% to 60% Optimal range Stable, well behaved for most PCR and cloning
Above 60% High GC Higher melting temperature; risk of hairpins and secondary structure

For primer and probe design, aim for the 40 to 60% window. Primers in this range strike a balance between binding strength and specificity, and they tolerate standard annealing temperatures without the additives often required for GC-rich templates. Sequences below 40% may need longer primers or lower annealing temperatures to remain stable, while sequences above 60% frequently demand DMSO, betaine, or specialized polymerases to suppress secondary structure.

At the genome scale, GC content is a taxonomic fingerprint. Mammalian genomes average roughly 41%, the human genome sits near 41% with substantial regional variation, and many bacterial genomes range from below 30% to above 70%. Comparing GC content across regions or organisms can reveal isochores, horizontally transferred islands, and codon-usage bias.

Where GC Content Matters

GC content quietly drives many bench decisions. The most common applications include:

  • PCR primer design: Targeting 40 to 60% GC keeps melting temperatures predictable and amplification efficient.
  • Melting temperature estimation: Because G-C pairs share three hydrogen bonds, higher GC content raises the temperature at which the duplex separates, feeding directly into Tm formulas.
  • qPCR and probe assays: Balanced GC content reduces nonspecific binding and improves the reproducibility of cycle-threshold values.
  • Next-generation sequencing: Extreme GC regions are prone to coverage bias, so knowing GC content helps interpret uneven read depth.
  • Synthetic biology and gene synthesis: Vendors often cap GC content to keep oligonucleotide synthesis reliable, and codon optimization tunes GC to match the host.
  • Comparative genomics: GC skew is used to pinpoint replication origins, and overall GC content distinguishes species and chromosomal domains.

Whether you are validating a single oligo or profiling a draft assembly, running the sequence through a DNA GC content calculator first gives you an instant sanity check before you commit reagents or sequencing lanes. Pairing this tool with a melting-temperature calculator and a molecular-weight calculator covers most of the front-end characterization an experiment needs.

Best Practices for Accurate GC Analysis

The accuracy of a GC content calculation depends entirely on the sequence you feed it. A few habits keep your results trustworthy. First, confirm that you pasted the strand you intend to analyze. GC content is identical on both strands of a duplex because G on one strand pairs with C on the other, but GC skew is strand-specific and flips sign on the complementary strand, so orientation matters when you interpret skew.

Second, remember that this calculator silently removes anything that is not A, T, G, C, or U. That is convenient for FASTA pasting, but it means ambiguity codes such as N, R, or Y are dropped rather than counted. If your sequence contains many ambiguous bases, the reported percentages describe only the unambiguous portion. Third, keep DNA and RNA separate: mixing T and U in one sequence will be tallied together in the AT fraction and may produce a misleading isRNA flag.

Finally, treat GC content as one input among several. A primer with perfect GC content can still fail because of a 3' hairpin, a primer-dimer, or a repeat. Use the GC value to narrow choices, then validate candidates with dedicated primer and secondary-structure tools before ordering.

Worked Examples

Default mixed sequence

Problem:

Find the GC content, AT content, and GC skew of ATGCGATCGATCGATCGAATTCCGG (the calculator's default input).

Solution Steps:

  1. 1Clean and count the 25 bases: A = 6, T = 6, G = 7, C = 6.
  2. 2GC content = (G + C) / N × 100 = (7 + 6) / 25 × 100 = 13 / 25 × 100 = 52.0%.
  3. 3AT content = (6 + 6) / 25 × 100 = 48.0%, and GC skew = (7 − 6) / (7 + 6) = 1 / 13 = 0.077.

Result:

GC content 52.0%, AT content 48.0%, GC skew 0.077 — squarely in the optimal 40 to 60% range.

A balanced PCR primer

Problem:

Evaluate the 16-mer primer GCGCGATCGTACGATC for primer-design suitability.

Solution Steps:

  1. 1Count the 16 bases: A = 3, T = 3, G = 5, C = 5.
  2. 2GC content = (5 + 5) / 16 × 100 = 10 / 16 × 100 = 62.5%.
  3. 3GC skew = (5 − 5) / (5 + 5) = 0.000, indicating a balanced G and C distribution.

Result:

GC content 62.5% (slightly above the ideal window), AT content 37.5%, GC skew 0.000 — usable but watch the annealing temperature.

A GC-rich fragment with strong skew

Problem:

Analyze the short fragment GGGGCCAA for GC content and both skew values.

Solution Steps:

  1. 1Count the 8 bases: A = 2, T = 0, G = 4, C = 2.
  2. 2GC content = (4 + 2) / 8 × 100 = 6 / 8 × 100 = 75.0%; AT content = (2 + 0) / 8 × 100 = 25.0%.
  3. 3GC skew = (4 − 2) / (4 + 2) = 2 / 6 = 0.333, and AT skew = (2 − 0) / (2 + 0) = 1.000.

Result:

GC content 75.0% (high — expect secondary structure), GC skew 0.333, AT skew 1.000.

Tips & Best Practices

  • Aim for 40 to 60% GC content when designing primers and probes.
  • Paste FASTA sequences freely — line breaks, spaces, and numbering are ignored automatically.
  • Remember GC content is identical on both strands, but GC skew flips sign on the complement.
  • For GC-rich templates above 60%, plan for DMSO, betaine, or a specialized polymerase.
  • Check that GC% and AT% sum to 100% as a fast sanity test of your input.
  • Use GC skew sign changes to help locate replication origins in bacterial genomes.
  • Treat GC content as a screen, then validate primers with a secondary-structure tool.
  • Keep DNA (T) and RNA (U) sequences separate to avoid a misleading RNA flag.

Frequently Asked Questions

Most primer-design guidelines recommend a GC content between 40% and 60%. This range gives a stable enough duplex for efficient annealing while avoiding the secondary structures that plague very GC-rich oligos. The calculator flags anything inside this window as optimal.
Guanine and cytosine form three hydrogen bonds with each other, whereas adenine and thymine form only two. More G-C pairs therefore mean more total hydrogen bonding holding the strands together, so it takes more thermal energy to separate them. That is why GC content is a key term in nearly every melting-temperature formula.
Yes. If the cleaned sequence contains uracil (U), the tool recognizes it as RNA, labels the base as Uracil instead of Thymine, and counts U toward the AT (really AU) fraction. GC content is computed the same way for RNA and DNA, since both still rely on G-C pairing.
GC skew is defined as (G − C) / (G + C) and measures whether guanine or cytosine is in excess on a single strand. It ranges from −1 to +1, with zero meaning the two bases are balanced. In genomics, the point where GC skew changes sign often marks a replication origin or terminus.
No. The calculator converts your input to uppercase and removes every character that is not A, T, G, C, or U before counting. You can paste FASTA-formatted sequences with line breaks and spacing, and only the valid nucleotides will be tallied. Note that ambiguity codes like N are also removed rather than counted.
Yes. Every base in the cleaned sequence is classified as either GC (G or C) or AT (A, T, or U), and the same total length is used as the denominator for both percentages. As a result the two values are exact complements and always sum to 100%, which is a quick way to confirm the calculation.

Sources & References

Last updated: 2026-06-05

💡

Help us improve!

How would you rate the DNA GC Content Calculator?

<>

Editorial Note

MyCalcBuddy Editorial Team

This page is maintained as an educational calculator reference.

Source

Formula Source: Standard Mathematical References

by Various

UpdatedLast reviewed: May 2026
CheckedFormula checks are based on standard references and internal QA review.

Privacy choices

MyCalcBuddy uses necessary storage for the site to work. Optional analytics, notifications, and future advertising features stay off unless you allow them.