Melting Temperature Calculator

Calculate DNA melting temperature (Tm) using multiple methods for accurate PCR primer design.

Primer Sequence

Calculation Methods

Basic (Wallace): Tm = 2(A+T) + 4(G+C)

Salt-adjusted: Accounts for ionic strength

Nearest-neighbor: Most accurate for primers

Recommended Tm

49.2°C
Salt-adjusted method | GC: 52.4%

Tm by Different Methods

Basic (Wallace Rule)64.0°C
Best for oligos under 14 bp
Salt-Adjusted49.2°C
Recommended for typical PCR primers
Nearest-Neighbor (approx)80.1°C
Thermodynamic calculation
GC-Adjusted54.4°C

PCR Recommendations

Annealing Temperature44.2°C
Tm - 5°C (typical starting point)
Extension Temperature72°C
Standard for Taq polymerase

Primer Properties

Length
21 bp
GC Content
52.4%
G + C
11
A + T
10

Quality Assessment

Length: Optimal (18-25 bp)
GC%: Optimal (40-60%)
!Tm: Consider adjusting

What Is DNA Melting Temperature (Tm)?

The melting temperature, abbreviated Tm, is the temperature at which exactly half of a double-stranded DNA duplex has separated, or "melted," into two single strands. At this point the population of molecules sits in equilibrium: 50% remain paired as a double helix and 50% have dissociated. This melting temperature calculator estimates Tm for a short DNA oligonucleotide such as a PCR primer, which is one of the single most important numbers in molecular biology because it dictates how hot or cold you run the annealing step of a polymerase chain reaction.

Base pairing in DNA is held together by hydrogen bonds and base-stacking interactions. Guanine and cytosine (G-C) pairs share three hydrogen bonds, while adenine and thymine (A-T) pairs share only two. Because G-C pairs are more stable, a primer rich in G and C melts at a higher temperature than an A-T rich primer of identical length. That is why GC content appears directly in nearly every Tm equation, and why this calculator reports the percentage of G plus C alongside every result.

Salt concentration matters too. Positively charged sodium (Na+) and magnesium (Mg2+) ions shield the negatively charged phosphate backbone, allowing the two strands to stay together at higher temperatures. Raising the salt concentration raises the Tm; lowering it drops the Tm. A reliable Tm calculator therefore takes sequence, length, GC content, and ionic strength into account, and this tool lets you enter primer concentration, Na+, and Mg2+ so the salt-adjusted estimate reflects your real reaction buffer.

The Tm Formulas This Calculator Uses

This melting temperature calculator reports Tm from several published methods so you can compare them. The headline "Recommended Tm" comes from the salt-adjusted formula, which is appropriate for typical primers in the 14 to 70 base-pair range. The other methods are shown for reference and for very short or very long oligos.

The Basic (Wallace) rule is the classic quick estimate for short oligonucleotides under about 14 bp: each A-T pair contributes 2 degrees and each G-C pair contributes 4 degrees Celsius. It ignores salt entirely, so it overestimates Tm for longer primers but is handy for a fast mental check.

The nearest-neighbor (NN) result uses a thermodynamic relationship built from average enthalpy (ΔH) and entropy (ΔS) values per base pair plus the primer concentration term. It is the basis of the most accurate published Tm models. Note that the version in this calculator uses single averaged ΔH and ΔS values rather than a full 16-doublet table, so it is a simplified approximation and tends to read high; treat the salt-adjusted number as your working value.

Method Equation used in the code Best for
Basic (Wallace) Tm = 2(A+T) + 4(G+C) Oligos under 14 bp
Salt-adjusted 81.5 + 16.6·log10([Na+]/1000) + 0.41·GC% − 675/L Typical PCR primers
GC-adjusted 64.9 + 41·(G+C − 16.4)/L Quick GC-based estimate
Nearest-neighbor (ΔH·1000)/(ΔS + R·ln(Ct/4)) − 273.15 Thermodynamic reference

In all of these, L is the primer length in bases, GC% is the percentage of guanine plus cytosine, and [Na+] is the sodium concentration in millimolar (converted to molar inside the log10 term by dividing by 1000).

Salt-Adjusted Melting Temperature

Tm = 81.5 + 16.6 × log10([Na+]/1000) + 0.41 × GC% − 675/L

Where:

  • Tm= Melting temperature in degrees Celsius
  • [Na+]= Sodium (monovalent salt) concentration in millimolar (mM)
  • GC%= Percentage of guanine + cytosine bases in the primer
  • L= Primer length in number of bases (bp)

How to Use the Melting Temperature Calculator

Using this Tm calculator takes only a few seconds. Start by pasting your DNA primer sequence into the sequence box, written 5' to 3'. The tool automatically uppercases the text and strips anything that is not an A, T, G, or C, so spaces, line breaks, and accidental characters are ignored. A valid sequence must contain at least four bases for a result to appear.

Next, set the three reaction parameters. Primer (nM) is the oligonucleotide concentration in nanomolar, which feeds the nearest-neighbor thermodynamic term. Na+ (mM) is the monovalent salt concentration; 50 mM is a common default for many buffers. Mg2+ (mM) records the magnesium concentration of your reaction, which is reported in the results for documentation. Three preset buttons load a balanced sequence, an all-GC sequence, and an all-AT sequence so you can instantly see how composition shifts the Tm.

The results panel shows the "Recommended Tm" from the salt-adjusted method in large type, followed by Tm from every method side by side, a suggested annealing temperature of Tm minus 5 degrees, a standard 72 degree extension temperature for Taq polymerase, and a primer quality assessment that flags length, GC content, and Tm against ideal design ranges. Use the recommended annealing temperature as a starting point and optimize empirically with a gradient PCR if your product is weak or nonspecific.

Why Salt, Length, and GC Content Change the Tm

Three variables dominate the melting behavior of any primer, and each one appears explicitly in the salt-adjusted equation. Understanding them helps you design primers that actually work the first time rather than guessing at annealing temperatures.

Length (L). Longer primers have more base pairs and more cumulative hydrogen bonding, so they melt at higher temperatures. In the salt-adjusted formula the term −675/L shrinks as L grows, which raises the Tm. A 12-base oligo and a 30-base oligo of the same GC content can differ by more than ten degrees. Most PCR primers land in the 18 to 25 base sweet spot, which the quality assessment flags as optimal.

GC content. Because G-C pairs carry three hydrogen bonds versus two for A-T, a higher GC percentage means a more thermally stable duplex. The 0.41·GC% term captures this: every additional percentage point of GC adds roughly four-tenths of a degree to the Tm. The calculator also warns when GC content falls outside the 40 to 60 percent window, which is the range that best balances stability and specificity.

Salt (Na+). Sodium and other monovalent cations neutralize the phosphate backbone's negative charge, reducing electrostatic repulsion between the strands and stabilizing the duplex. The 16.6·log10([Na+]/1000) term is negative at low salt and rises toward zero as salt increases, so doubling the salt concentration meaningfully raises the predicted Tm. Magnesium ions (Mg2+) have an even stronger per-ion effect in real reactions, which is why this melting temperature calculator records your Mg2+ value even though the salt-adjusted equation is driven primarily by Na+.

Designing Better PCR Primers With Tm

A great melting temperature calculator is only useful if you act on the numbers. For standard PCR, aim for primers with a Tm between 55 and 65 degrees Celsius, and keep the forward and reverse primer Tm values within about 5 degrees of each other so they anneal efficiently in the same cycle. Matching the pair is often more important than hitting an exact absolute value.

Set your initial annealing temperature about 5 degrees below the lower primer Tm; this tool suggests exactly that with its annealing temperature output. If you see primer-dimers or nonspecific bands, raise the annealing temperature to increase stringency. If the target band is faint or absent, lower it a few degrees. A gradient thermocycler lets you test a range in a single run and pick the cleanest result.

Beyond Tm, good primers avoid long runs of a single base, strong self-complementarity that forms hairpins, and 3' ends that are complementary to each other. Keeping GC content in the 40 to 60 percent band and length in the 18 to 25 base range, both of which the quality panel checks, gives you a primer that is specific and amplifies cleanly. Use the GC clamp principle by ending the primer with one or two G or C bases to anchor the 3' end during extension.

Accuracy and Limitations

No Tm formula is perfect, and the methods in this calculator each have a domain where they shine and ranges where they drift. The Wallace rule is fast but ignores salt and length corrections, so it inflates Tm for primers longer than about 14 bases. The salt-adjusted and GC-adjusted equations are solid empirical fits for the 14 to 70 base range and are what most everyday primer design relies on.

The nearest-neighbor output in this tool uses single averaged enthalpy and entropy constants rather than the full SantaLucia 16-dinucleotide parameter set, so it is an approximation that systematically reads several degrees high; use it for relative comparison, not as an absolute target. Likewise, the calculator emphasizes monovalent Na+ in the salt term, while real PCR is strongly influenced by Mg2+, dNTPs, and DMSO that are not fully modeled here.

Treat every computed Tm as a well-informed starting estimate rather than a guaranteed value. The most reliable workflow is to use this melting temperature calculator to get into the right neighborhood, then confirm the optimal annealing temperature empirically with a gradient PCR. For demanding applications such as qPCR probe design or allele-specific amplification, cross-check with a full nearest-neighbor thermodynamic tool that uses experimentally measured parameters.

Worked Examples

Default 21-base primer at 50 mM Na+

Problem:

Find the salt-adjusted Tm and annealing temperature for ATGCGATCGATCGATCGATGC with 50 mM Na+.

Solution Steps:

  1. 1Count bases: length L = 21, with G = 6 and C = 5, so G+C = 11 and GC% = 11/21 × 100 = 52.38%.
  2. 2Salt term: 16.6 × log10(50/1000) = 16.6 × (−1.301) = −21.60.
  3. 3Combine: Tm = 81.5 + (−21.60) + 0.41 × 52.38 − 675/21 = 81.5 − 21.60 + 21.48 − 32.14.
  4. 4Annealing temperature = Tm − 5 = 49.24 − 5 = 44.24°C.

Result:

Salt-adjusted Tm ≈ 49.2°C; suggested annealing temperature ≈ 44.2°C.

All-GC 16-mer (Wallace vs salt-adjusted)

Problem:

Compare the Wallace and salt-adjusted Tm for GCGCGCGCGCGCGCGC at 50 mM Na+.

Solution Steps:

  1. 1Composition: L = 16, all G/C so G+C = 16, A+T = 0, GC% = 100%.
  2. 2Wallace rule: Tm = 2 × 0 + 4 × 16 = 64.0°C.
  3. 3Salt-adjusted: Tm = 81.5 + 16.6 × log10(0.05) + 0.41 × 100 − 675/16 = 81.5 − 21.60 + 41.0 − 42.19.
  4. 4The two methods disagree because Wallace ignores both length and salt corrections.

Result:

Wallace Tm = 64.0°C, salt-adjusted Tm ≈ 58.7°C.

All-AT 14-mer shows how low Tm drops

Problem:

Calculate the salt-adjusted Tm for ATATATATATATAT at 50 mM Na+.

Solution Steps:

  1. 1Composition: L = 14, A+T = 14, G+C = 0, so GC% = 0%.
  2. 2Wallace rule: Tm = 2 × 14 + 4 × 0 = 28.0°C.
  3. 3Salt-adjusted: Tm = 81.5 + 16.6 × log10(0.05) + 0.41 × 0 − 675/14 = 81.5 − 21.60 + 0 − 48.21.
  4. 4The very low GC content makes this duplex melt far below room-temperature PCR conditions.

Result:

Wallace Tm = 28.0°C, salt-adjusted Tm ≈ 11.7°C — far too low for reliable PCR.

GC-adjusted method on the 21-base primer

Problem:

Use the GC-adjusted formula for ATGCGATCGATCGATCGATGC (G+C = 11, L = 21).

Solution Steps:

  1. 1Apply Tm = 64.9 + 41 × (G+C − 16.4)/L.
  2. 2Substitute: Tm = 64.9 + 41 × (11 − 16.4)/21 = 64.9 + 41 × (−5.4)/21.
  3. 3Compute: 41 × (−5.4)/21 = −221.4/21 = −10.54.
  4. 4Add: Tm = 64.9 − 10.54 = 54.36°C.

Result:

GC-adjusted Tm ≈ 54.4°C, a few degrees above the salt-adjusted estimate for the same primer.

Tips & Best Practices

  • Aim for a primer Tm between 55 and 65°C for standard PCR.
  • Keep forward and reverse primer Tm values within 5°C of each other.
  • Start annealing at Tm − 5°C, then optimize with a gradient PCR.
  • Target 18-25 bases in length and 40-60% GC content for specificity.
  • End primers with a G or C (a GC clamp) to anchor the 3' end.
  • Use the salt-adjusted Tm as your working value, not the nearest-neighbor approximation.
  • Enter your real Na+ and Mg2+ buffer concentrations for a relevant estimate.
  • Raise annealing temperature to reduce nonspecific bands and primer-dimers.

Frequently Asked Questions

Tm is the temperature at which half of a double-stranded DNA molecule has separated into two single strands while the other half remains paired. It is a measure of duplex stability that depends mainly on length, GC content, and salt concentration. For PCR primers, Tm tells you roughly how hot to run the annealing step.
For typical primers between 14 and 70 bases, use the salt-adjusted value, which is the headline 'Recommended Tm.' The Wallace rule is only reliable for very short oligos under about 14 bases. The nearest-neighbor figure here uses averaged constants and tends to read high, so treat it as a relative reference rather than an exact target.
Guanine-cytosine pairs form three hydrogen bonds while adenine-thymine pairs form only two, so higher GC content produces a more stable, higher-melting duplex. In the salt-adjusted formula, each percentage point of GC adds about 0.41 degrees to the Tm. That is why an all-GC primer melts much higher than an all-AT primer of the same length.
A common starting point is the primer Tm minus 5 degrees Celsius, which this calculator reports automatically. Keep the forward and reverse primers within about 5 degrees of each other for efficient pairing. If you get nonspecific bands raise the annealing temperature, and if the product is weak lower it; a gradient PCR finds the optimum quickly.
Positively charged ions like Na+ and Mg2+ shield the negatively charged DNA phosphate backbone, reducing the repulsion between the two strands and stabilizing the duplex. More salt therefore raises the melting temperature. The salt-adjusted equation in this tool uses the Na+ term directly, while the Mg2+ value you enter is recorded for documenting your reaction conditions.
Most reliable primers are 18 to 25 bases long with 40 to 60 percent GC content and a Tm between 55 and 65 degrees Celsius. The quality assessment panel in this calculator checks all three of these ranges. Staying inside them, plus avoiding hairpins and primer-dimers, gives clean, specific amplification.

Sources & References

Last updated: 2026-06-05

💡

Help us improve!

How would you rate the Melting Temperature Calculator?

<>

Editorial Note

MyCalcBuddy Editorial Team

This page is maintained as an educational calculator reference.

Source

Formula Source: Standard Mathematical References

by Various

UpdatedLast reviewed: May 2026
CheckedFormula checks are based on standard references and internal QA review.

Privacy choices

MyCalcBuddy uses necessary storage for the site to work. Optional analytics, notifications, and future advertising features stay off unless you allow them.