Nucleotide Calculator
Analyze nucleotide composition and calculate molecular properties
Sequence Input
Valid characters: A, T, G, C
Nucleotide Composition
Sequence Length
24 nt
GC Content
50.0%
AT Content
50.0%
Molecular Properties
What Is a Nucleotide Calculator?
A nucleotide calculator analyzes a DNA or RNA sequence and reports its composition and key physical properties from a single string of bases. Paste a sequence written 5' to 3', choose whether it is DNA or RNA, and the tool counts each base, computes percentages, derives GC content, estimates molecular weight in daltons, and calculates the molar extinction coefficient at 260 nm along with conversion factors used to turn an absorbance reading into concentration.
These numbers are the everyday currency of any molecular biology bench. When you order an oligonucleotide, run a PCR, normalize a primer stock, or quantify a nucleic acid prep on a spectrophotometer, you rely on exactly these values. Rather than looking them up in a synthesis report or guessing, this DNA composition calculator computes them instantly so you can plan dilutions, set annealing temperatures, and convert OD260 readings into nanomoles and micrograms with confidence.
The calculator only counts valid characters. Any letter that is not A, T, G, C, or U is stripped before the math runs, so spaces, line breaks, FASTA headers, and stray numbers are ignored automatically. This means you can copy a sequence directly out of a sequencing trace, a plasmid map, or a primer design tool without cleaning it up first.
How the Nucleotide Calculator Works
The engine first sanitizes the input: it uppercases the text and removes every character that is not A, T, G, C, or U. The remaining string is your working sequence, and its character count is the sequence length in nucleotides (nt). Each base is then counted with a simple pattern match, and each count is divided by the length and multiplied by 100 to give a percentage.
GC content is the fraction of guanine plus cytosine, while AT content (or AU content for RNA) is the complementary fraction of adenine plus thymine (or uracil). Because every position is one of the four bases, GC% and AT% always add up to 100% for a clean sequence.
Molecular weight uses per-residue monophosphate masses and subtracts one water-equivalent (61.97 Da) for every phosphodiester bond formed, that is, for each of the (length minus 1) linkages between residues. DNA and RNA use different residue masses because RNA carries an extra hydroxyl and uses uracil in place of thymine.
The extinction coefficient at 260 nm uses a per-base approximation: A = 15,400, G = 11,500, C = 7,400, and T or U = 8,700 M-1cm-1. Summing these gives the single-stranded value; the double-stranded estimate applies a hypochromicity factor of 0.9. From the single-stranded extinction coefficient the tool derives nmol/OD260 and µg/OD260, the two factors you multiply an absorbance reading by to recover amount of substance and mass.
Core Nucleotide Equations
Where:
- A, T, G, C, U= Number of each nucleotide counted in the sequence
- L= Total sequence length in nucleotides (sum of all base counts)
- MW= Molecular weight in daltons (Da); RNA uses 347.2A, 324.2U, 363.2G, 323.2C
- GC%= Percentage of guanine plus cytosine bases
- e260= Single-stranded molar extinction coefficient at 260 nm (M^-1 cm^-1)
Why GC Content Matters
GC content is one of the most useful single numbers the calculator reports. Each guanine-cytosine base pair is held together by three hydrogen bonds, while each adenine-thymine pair has only two. As a result, sequences richer in G and C are more thermally stable, melt at higher temperatures, and form tighter duplexes.
For PCR primers, GC content directly influences the melting temperature and how cleanly a primer anneals. Most primer design guidelines aim for a GC content between roughly 40% and 60%; values outside that band can cause weak binding (too low) or stubborn secondary structure and mispriming (too high). The default sequence in this tool has a balanced GC content of 50.0%, which is close to the ideal target for a typical primer.
GC content also varies systematically across genomes and organisms, and it affects how easily a region can be sequenced or amplified. GC-rich stretches often need additives or higher denaturation temperatures, while GC-poor regions melt readily but may give nonspecific products. Reading the GC% from this GC content calculator before you design or order anything saves time at the bench.
From Extinction Coefficient to Concentration
Nucleic acids absorb ultraviolet light strongly at 260 nm, and that absorbance is how almost every lab quantifies DNA and RNA. The link between the absorbance reading and concentration is the extinction coefficient (e260), and the calculator produces it directly from your sequence.
Two derived numbers make this practical. The nmol/OD260 value tells you how many nanomoles of the molecule correspond to one optical density unit, so multiplying it by your measured OD260 gives the amount of substance. The µg/OD260 value does the same in mass units. These are exactly the figures printed on an oligo synthesis report, and they let you resuspend a dried primer to a precise micromolar stock without a separate calibration.
The relationship rests on the Beer-Lambert law, A = e × c × l, where A is absorbance, c is molar concentration, and l is path length in centimeters. Because the calculator gives you e260, you can rearrange to c = A / (e × l) and convert any 260 nm reading into a concentration. The double-stranded extinction estimate (the single-stranded value times 0.9) accounts for hypochromicity, the dampening of absorbance that occurs when bases stack in a duplex.
DNA vs RNA Mode
Switching the sequence type changes both the alphabet and the underlying constants. In DNA mode the valid bases are A, T, G, and C, and the residue masses used are dAMP = 331.2, dTMP = 322.2, dGMP = 347.2, and dCMP = 307.2 Da. In RNA mode thymine is replaced by uracil, the valid bases become A, U, G, and C, and the masses change to AMP = 347.2, UMP = 324.2, GMP = 363.2, and CMP = 323.2 Da.
RNA residues are heavier than their DNA counterparts because ribose carries an additional 2'-hydroxyl group. That is why an RNA sequence of the same length and base count will report a larger molecular weight than the equivalent DNA sequence. The extinction-coefficient contributions stay the same per base (uracil uses the same 8,700 M-1cm-1 as thymine in this approximation), so the main numerical difference you see between modes is in the molecular weight.
The composition panel also adapts: in DNA mode it shows the thymine count and AT content, while in RNA mode it shows the uracil count and AU content. Choosing the right mode ensures the reported mass and concentration factors match the molecule you actually have in the tube.
| Property | DNA mode | RNA mode |
|---|---|---|
| Valid bases | A, T, G, C | A, U, G, C |
| Adenine residue (Da) | 331.2 | 347.2 |
| T / U residue (Da) | 322.2 (T) | 324.2 (U) |
| Guanine residue (Da) | 347.2 | 363.2 |
| Cytosine residue (Da) | 307.2 | 323.2 |
How to Use the Calculator
Using the nucleotide calculator takes three steps. First, select the sequence type, DNA or RNA, from the dropdown so the correct residue masses and base alphabet apply. Second, paste your sequence into the text box in the 5' to 3' direction; you can leave spaces, line breaks, or numbers in place because the tool filters out anything that is not a valid base. Third, read the results, which update instantly as you type.
The left panel shows nucleotide counts and percentages with color-coded bars, while the right panel reports sequence length, GC content, AT or AU content, molecular weight in daltons and kilodaltons, the single-stranded extinction coefficient, and the nmol/OD260 and µg/OD260 conversion factors. To compare two oligos, simply paste each in turn and note how length and GC content shift the molecular weight and concentration factors. This makes the tool a fast companion for primer ordering, qPCR setup, and routine spectrophotometric quantification.
Worked Examples
24-nt DNA oligo (default sequence)
Problem:
Analyze the DNA sequence ATGCGATCGATCGATCGATCATGC and find its GC content, molecular weight, and extinction coefficient.
Solution Steps:
- 1Count the bases: A = 6, T = 6, G = 6, C = 6, for a total length L = 24 nt.
- 2GC content = (G + C) / L x 100 = (6 + 6) / 24 x 100 = 50.0%.
- 3Molecular weight = 6(331.2) + 6(322.2) + 6(347.2) + 6(307.2) - 61.97 x 23 = 6421.5 Da.
- 4Extinction coefficient e260 = 6(15400) + 6(11500) + 6(7400) + 6(8700) = 258,000 M^-1 cm^-1, giving nmol/OD260 = 1,000,000 / 258,000 = 3.876.
Result:
GC content 50.0%, molecular weight 6421.5 Da (6.42 kDa), e260 = 258,000 M^-1 cm^-1, nmol/OD260 = 3.876, and ug/OD260 = 24.89.
Short RNA sequence
Problem:
Switch to RNA mode and analyze the sequence AUGCAUGC.
Solution Steps:
- 1Count the bases: A = 2, U = 2, G = 2, C = 2, for a length L = 8 nt.
- 2GC content = (2 + 2) / 8 x 100 = 50.0%.
- 3Molecular weight (RNA masses) = 2(347.2) + 2(324.2) + 2(363.2) + 2(323.2) - 61.97 x 7 = 2281.8 Da.
- 4e260 = 2(15400) + 2(11500) + 2(7400) + 2(8700) = 86,000 M^-1 cm^-1, so nmol/OD260 = 1,000,000 / 86,000 = 11.628.
Result:
GC content 50.0%, molecular weight 2281.8 Da, e260 = 86,000 M^-1 cm^-1, nmol/OD260 = 11.628, and ug/OD260 = 26.53.
GC-rich DNA segment
Problem:
Analyze the GC-rich DNA sequence GCGCGC to see how composition drives stability.
Solution Steps:
- 1Count the bases: A = 0, T = 0, G = 3, C = 3, for a length L = 6 nt.
- 2GC content = (3 + 3) / 6 x 100 = 100.0%, the maximum possible value.
- 3Molecular weight = 3(347.2) + 3(307.2) - 61.97 x 5 = 1653.3 Da.
- 4e260 = 3(11500) + 3(7400) = 56,700 M^-1 cm^-1, so nmol/OD260 = 1,000,000 / 56,700 = 17.637.
Result:
GC content 100.0%, molecular weight 1653.3 Da, e260 = 56,700 M^-1 cm^-1, and nmol/OD260 = 17.637, reflecting a maximally stable, fully GC duplex.
Tips & Best Practices
- โEnter your sequence in the 5' to 3' direction for consistency with synthesis reports.
- โPick DNA or RNA mode first so the correct residue masses and base alphabet apply.
- โAim for a GC content between 40% and 60% when designing PCR primers.
- โYou can paste sequences with spaces, line breaks, or numbers; non-base characters are ignored.
- โUse the nmol/OD260 factor to resuspend a dried oligo to a precise micromolar stock.
- โCompare two oligos by pasting each in turn and noting how length shifts molecular weight.
- โRemember RNA reports a higher molecular weight than DNA of the same length and composition.
- โUse the double-stranded extinction estimate (single-stranded times 0.9) for annealed duplex DNA.
Frequently Asked Questions
Sources & References
Last updated: 2026-06-05
Help us improve!
How would you rate the Nucleotide Calculator?
Editorial Note
MyCalcBuddy Editorial Team
This page is maintained as an educational calculator reference.
Formula Source: Standard Mathematical References
by Various